Nasal Colonization of Serine Protease esp-Positive Staphylococcus epidermidis Affecting Staphylococcus aureus Colonization
Department of Laboratory Medicine, Hallym University College of Medicine, Seoul, Korea
ABSTRACT
Background: Staphylococcus aureus is a common colonizer of the nasal vestibule and is found in approximately 20%–30% of healthy adults, while Staphylococcus epidermidis appears to be the most frequent colonizer in all regions of the upper respiratory tract. Esp, a serine protease of S. epidermidis, was reported to inhibit S. aureus colonization. This study was performed to examine the nasal colonization of S. aureus and S. epidermidis and the presence of esp determinants.
Methods: Nasal swab specimens from 54 patients were cultured on blood agar plates (BAP) and selective media for S. aureus (S. aureus ID, bioMerieux, France) for the isolation of S. aureus and S. epidermidis. After 48 hours of incubation of with BAP, three or four colonies suspected of being coagulase-negative staphylococci (CNS) were identified by MALDI-TOF MS (Bruker, Germany). Polymerase chain reaction (PCR) for esp was performed on all CNS isolates identified as S. epidermidis.
Results: Forty-three S. epidermidis strains were isolated from 18 (33.3%) of the 54 patients. Nine (50.0%) of the 18 patients carried S. aureus, while the other nine did not. Of the 36 S. epidermidis non-carriers, 13 (36.1%) were colonized by S. aureus. All S. epidermidis strains were confirmed by PCR to have esp determinants.
Conclusion: S. epidermidis colonization did not affect S. aureus colonization in the nasal cavity. All S. epidermidis strains harbored the esp gene. We could not find any differences in the nasal colonization rates of S. aureus according to the presence of esp-positive S. epidermidis. Further research on the characterization of S. epidermidis in Korea is needed to understand the association between S. epidermidis and S. aureus colonization.
Keywords
Colonization, esp, Serine protease, Staphylococcus aureus, Staphylococcus epidermidis
INTRODUCTION
Staphylococcus aureus는 사람의 비강내에 주로 집락화하며, 20-30%의 사람은 비강내에 S. aureus를 보유하고 있다. 비강내에 S. aureus를 보균한 입원환자에서는 S. aureus에 의한 기회감염의 위험이 증가하며, 때로는 창상감염을 비롯한 심각한 감염을 일으키기도 한다[1,2]. 또한 환자 입원시 S. aureus 보균자를 검사하여 치료하게 되면 수술후 창상감염의 위험을 줄일 수 있다고 알려져 있다[3-5]. 일반적으로 세균의 비강 집락화에는 비강조직 부착능, 균 성장에 필요한 영양소, 항균물질 생성 등의 여러 요소가 작용하며 균주간 작용 또는 인체의 면역기능과의 작용 등 복잡한 상호작용이 관여한다[6]. 일부 Staphylococcus 균종은 다당류와 단백질, teichoic acid, 세포외 DNA 등의 복합체로 이루어진 생물막을 형성하면서 인체 방어기전이나 항생제, 소독제로부터 자신을 보호하는 기전이 알려져 있다[7].
Staphylococcus epidermidis는 주로 피부와 비강내에서 집락을 이루는데, serine protease의 일종인 Esp를 생성하는 S. epidermidis는 S. aureus의 생물막 생성을 억제하여 S. aureus가 비강내에 정착하는 것을 억제한다고 보고되었다[8,9]. Esp는 생물막 형성에 관련된 extracellular adherence protein, extracellular matrix protein-binding protein, fibronectin-binding protein A 및 protein A 등 여러 단백질들을 분해할 수 있으므로[9], Esp를 생성하는 S. epidermidis의 특성을 이용하여 S. aureus 보균을 막거나 치료에 사용하려는 시도가 있다.
기존의 여러 연구를 통해 Esp 생성 S. epidermidis가 S. aureus의 비강내 집락 형성을 억제한다고 알려져 있으나, 국내에서는 S. epidermidis 임상 균주에 대한 esp 보유 여부에 대한 보고가 없다. 이 연구는 입원환자를 대상으로 S. aureus와 S. epidermidis의 비강내 보유 여부를 조사하고, S. aureus 보균 억제와 esp 양성 S. epidermidis의 연관성을 알아보고자 시행하였다.
MATERIALS AND METHODS
1. 대상 및 검체
2014년 7월에서 9월까지 서울의 한 종합병원에 입원한 54명의 환자의 비강도말 검체를 blood agar plate (BAP)와 선택 배지인 S. aureus ID (SAID; bioMerieux, Marcy-l’Etoile, France)에 접종한 후 35°C, 호기성 배양환경에서 48시간 배양하였다. S. aureus 선택배지에서 S. aureus로 의심되는 초록색 균집락을 선택하였고, BAP에서 coagulase-negative staphylococci로 의심되는 흰색 균 집락 3-4개를 선택하여 BAP에 계대배양한 후 matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS; Bruker, Bremen, Germany)로 동정하여 S. epidermidis인지 확인하였다. 비강외에서 분리된 S. epidermidis 균주의 esp 유전자 여부를 조사하기 위해 동일 기간 다른 환자의 혈액에서 분리된 S. epidermidis 19 균주도 추가로 연구대상(KD-2015-01)에 포함하였다.
2. Staphylococcus epidermidis esp PCR
S. epidermidis esp (serine protease) polymerase chain reaction (PCR)은 기존 보고와 같이 시행하였다[8]. DNA 추출은 HiYield Genomic DNA Mini kit (RBC, New Taipei City, Taiwan)를 사용하였고, PCR primer는 Esp_F (TTTGGAGGTTATCATATGAAAAAGAG)와 Esp_R (CTGAATATTTATATCAGGTATATTGTTTC)를 사용하여 Solgent Taq polymerase kit (Solgent, Daejeon, Korea)로 95°C, 4분 반응 후 95°C, 30초, 48°C, 30초, 72°C, 40초 조건으로 30회 반복하고, 72°C, 4분간 반응하였다. 2% agarose gel로 전기영동 후 854 bp의 PCR 산물을 확인하였다.
3. 통계 분석
S. epidermidis 보균과 S. aureus 보균 자료로 chi-square test를 Sigma plot software 13.0 (Systat Software, Ekrath, Germany)으로 시행하였다.
RESULTS
대상군 54명 중 18명(33.3%)에서 S. epidermidis가 검출되었다. S. aureus는 54명 중 22명(40.7%)에서 검출되었다. S. epidermidis 보균자 18명에서는 9명 (50.0%)에서 S. aureus가 배양되었으며, S. epidermidis 비보균자 36명 중 13명(36.1%)에서 S. aureus가 배양되었다(Table 1). S. epidermidis 보균에 따른 S. aureus 보균자의 차이는 통계적으로 유의하지 않았다(P = 0.493). S. epidermidis 균주는 모두 esp 유전자가 검출되어서 esp 유전자 보유에 따른 차이도 관찰할 수 없었다.
Table 1. Nasal colonization of Staphylococcus aureus and Staphylococcus epidermidis for its presence of esp gene (n = 54)
|
Groups |
S. aureus colonization |
||
|
Carrier (n = 22) |
Non-carrier (n = 32) |
||
|
S. epidermidis colonization |
Carrier (n = 18) |
9 |
9 |
|
Non-carrier (n = 36) |
13 |
23 |
|
|
esp-positive S. epidermidis colonization* |
Carrier (n = 18) |
9 |
9 |
|
Non-carrier (n = 36) |
13 |
23 |
|
|
*All the S. epidermidis isolates showed esp gene positivity by polymerase chain reaction (PCR). |
|||
S. epidermidis 균주에 대한 esp PCR 결과, S. epidermidis가 비강에서 분리된 18명에서 중복 균주를 포함하여 총 43개 S. epidermidis 균주를 전부 시행했는데, 모든 균주에서 esp PCR 양성을 보였다. 비교를 위해 다른 환자의 혈액에서 분리된 S. epidermidis 19 균주에서도 모두 esp PCR 양성을 보였다.
DISCUSSION
S. aureus와 S. epidermidis는 비강내에서 흔히 분리되는 균종이며, S. aureus 보균자는 S. aureus에 의한 기회 감염의 위험이 높은 것으로 알려져 있다. S. epidermidis는 병원감염에 중요한 원인균 중의 하나로 카테터 연관 감염의 흔한 원인이다. S. epidermidis는 병원성이 강한 병독성 인자가 거의 없으며, 인체 피부 세균총에서 다른 세균과 균형을 이루면서 집락화한다[10]. 균 집락의 요인에 대해서는 세균간 또한 세균과 숙주간의 반응이 복잡하여 파악하기 쉽지 않지만, 병원성 미생물을 다른 미생물로 억제하는 여러 연구가 진행중이며, 최근에는 마우스 비강내 S. epidermidis가 면역반응을 유도함으로써 influenza virus에 대한 항바이러스 효과를 보인다는 연구도 시도하고 있다[11].
S. epidermidis의 serine protease인 Esp는 S. aureus 생물막을 분해하는 특성이 있어, S. aureus의 생물막 억제제로 사용 가능하다는 연구가 있다[8]. 즉 S. aureus의 생물막 형성을 억제하는 일부 S. epidermidis는 비강에서 S. aureus를 정착하기 어렵게 하므로, 이러한 균주의 보유자는 S. aureus의 비강 보균율이 낮으며, Esp를 S. aureus의 보균자 제균에 사용하고 나아가서 치료에 활용할 가능성이 있다고 한다. 하지만, 국내의 임상분리 S. epidermidis 균주의 esp 유전자에 대한 조사는 거의 없다.
이번 연구에서는 환자의 비강 검체에서 S. aureus와 S. epidermidis를 배양하여, 각 균주의 보균이 영향을 주는지를 파악하고 S. epidermidis 균주에서 esp 유전자 유무를 조사하였다. 하지만, S. epidermidis 균주 모두에서 esp 유전자가 양성을 보였고 혈액내에서 분리된 여러 S. epidermidis 균주들도 모두 esp 양성을 보였으므로 esp 유전자는 대부분의 균주에서 보유하고 있을 것으로 추정된다. 따라서, S. epidermidis 균주의 esp 유무와 S. aureus 균주의 비강정착의 연관성을 추정하기는 어려웠다. 향후 연구에서는 국내외의 S. epidermidis의 균주 특성을 감안해야 할 것으로 생각한다. 다만, 이 연구에서는 esp 유전자 유무를 조사하여 Esp 생성량 및 serine protease의 활성을 측정한 것은 아니므로 직접적인 비교는 어려운 한계가 있다.
비강내에는 다양한 미생물이 균총을 이루고 있으므로[1,6,12], 일부 특성을 가진 하나의 세균에 의해 다른 세균의 균집락화를 설명하기는 어려울 수 있다. S. aureus가 비강내에 집락화하는 경우 여러 인자의 영향을 받는데, 세균 요인으로는 S. epidermidis, Streptococcus pneumoniae, Corynebacterium spp. 등이 있고, 인체의 유전적 요인으로는 IL-4, Toll-like receptor 등이 있으며, 면역학적 요인으로는 TLR2나 antimicrobial peptide, 여러 항체 등이 있고, 연령, 성, 흡연 등도 관련이 있다[2]. 따라서, 이번 연구에서처럼 단일 균종의 단일 유전자 특성만으로는 연관성을 밝히기 어려울 수도 있다.
Esp와 S. aureus 집락에 미치는 영향을 처음 밝힌 논문에서는 S. aureus 생물막을 억제할 수 있는 S. epidermidis가 전체 S. epidermidis의 51.2%였으나[8], 이 균주들의 esp 유전자 유무를 제시하지는 않았다. 한편, 노르웨이의 건강한 청소년을 대상으로 한 연구에서는 S. aureus의 비강내 보유와 S. epidermidis의 생물막 억제능 사이에는 연관이 없었으며, S. epidermidis 배양 상층액이 S. aureus의 생물막을 억제하는 균주의 경우에서도 S. aureus 보균을 억제할 수 없었다고 하며[12], 이 둘 사이의 관계를 증명하기 위해서는 다양한 임상 연구가 필요할 것으로 보인다. 또한, 2019년에 미국에서 보고된 신생아 대상 연구에서도 비강내 S. epidermidis의 존재는 S. aureus의 집락화를 막는 효과가 있으나, Esp 이외의 다른 기전을 가지는 protease가 있을 것으로 추정된다고 하였다[13].
S. aureus 의 비강 집락화를 억제하면, 환자의 내인성 S. aureus 감염을 줄일 수 있을 것으로 기대하고 있으며, S. epidermidis의 Esp가 S. aureus의 생물막 형성을 억제할 수 있다고 알려져 있으나, Esp의 발현량과 S. aureus의 생물막 억제에 대한 직접적인 영향은 아직 불분명하며, S. epidermidis의 3분의 2 정도 균주에서는 균주의 배양상층액이 S. aureus 성장을 억제하지 않지만 생물막은 억제한다고 하며, Esp 발현량과는 역시 무관하다고 알려져 있다[14]. 따라서, 비강내에서 S. epidermidis의 S. aureus 보균 억제능에 대해서는 추가적인 연구가 필요할 것으로 보인다.
이번 연구에서는 입원환자의 비강에서 S. aureus와 S. epidermidis의 보균 여부를 조사하고 비강내 esp 양성인 S. epidermidis와 S. aureus의 연관성을 살펴보고자 하였다. 그 결과, 대부분 S. epidermidis는 esp 양성을 보였으며, S. epidermidis의 esp 보유 여부는 S. aureus의 비강 집락에는 영향을 미치지 못하는 것으로 보인다.
요약
배경: Staphylococcus aureus는 건강인의 20%-30%의 비강에서 분리되는 상재균이며, Staphylococcus epidermidis는 상부 호흡기 여러 곳에서 가장 흔히 분리되는 세균이다. S. epidermidis 에 있는 serine protease의 일종인 Esp는 S. aureus와 경쟁적으로 작용하여 S. aureus의 집락화를 억제한다고 알려져 있다. 이 연구는 비강내 S. aureus와 S. epidermidis를 배양하여 S. epidermidis의 집락화, 이 균주의 esp 유전자 보유 여부와 S. aureus 비강 집락화와의 연관에 대해 알아보고자 하였다.
방법: 54명의 환자에서 수집한 비강도말 검체를 혈액한천 배지와 S. aureus ID 선택 배지(bioMerieux, France)에 배양하였다. 혈액한천 배지는 48시간 배양하여 coagulase-negative staphylococci로 의심되는 집락 3-4개를 선택하여 MALDI-TOF MS (Bruker, Germany)로 균종을 확인하였다. S. epidermidis로 확인된 균주는 PCR로 esp 유전자를 검사하였다.
결과: S. epidermidis는 18명의 환자로부터 43 균주가 분리되었고, 18명 중 9명(50%)은 S. aureus를 보균하고 있었다. S. epidermidis 비보균자 36명 중에서는 13명(36.1%)에서 S. aureus가 분리되었다. S. epidermidis 모든 균주에서 esp 유전자가 검출되었다.
결론: 연구 결과 비강내 S. epidermidis의 집락화가 S. aureus 보균에 미치는 영향은 없었다. 모든 S. epidermidis가 esp를 가지고 있으므로, esp 유전자의 유무와 비강내 S. aureus 집락화는 연관성이 없는 것으로 보인다. 비강내 집락화 과정에서 S. aureus와 S. epidermidis의 상호작용에 대해서는 추가적인 연구가 필요할 것으로 보인다.
CONFLICTS OF INTEREST
No potential conflicts of interest relevant to this article were reported.
FUNDING
이 연구는 보건산업진흥연구원 (HI17C2067) 연구지원으로 수행되었음.
REFERENCES
1. Sakr A, Bregeon F, Mege JL, Rolain JM, Blin O. Staphylococcus aureus nasal colonization: an update on mechanisms, epidemiology, risk factors, and subsequent infections. Front Microbiol 2018;9:2419. 
2. Mulcahy ME and McLoughlin RM. Host-bacterial crosstalk determines Staphylococcus aureus nasal colonization. Trends Microbiol 2016;24:872-86.
3. Bode LGM, Kluytmans JA, Wertheim HF, Bogaers D, Vandenbroucke-Grauls CM, Roosendaal R, et al. Preventing surgical-site infections in nasal carriers of Staphylococcus aureus. N Engl J Med 2010;362:9-17.
4. Perl TM. Prevention of Staphylococcus aureus infections among surgical patients: beyond traditional perioperative prophylaxis. Surgery 2003;134:S10-7.
5. Perl TM, Cullen JJ, Wenzel RP, Zimmerman MB, Pfaller MA, Sheppard D, et al. Intranasal mupirocin to prevent postoperative Staphylococcus aureus infections. N Engl J Med 2002;346:1871-7.
6. Krismer B, Weidenmaier C, Zipperer A, Peschel A. The commensal lifestyle of Staphylococcus aureus and its interactions with the nasal microbiota. Nat Rev Microbiol 2017;15:675-87.
7. Arciola CR, Campoccia D, Speziale P, Montanaro L, Costerton JW. Biofilm formation in Staphylococcus implant infections. A review of molecular mechanisms and implications for biofilm-resistant materials. Biomaterials 2012;33:5967-82.
8. Iwase T, Uehara Y, Shinji H, Tajima A, Seo H, Takada K, et al. Staphylococcus epidermidis Esp inhibits Staphylococcus aureus biofilm formation and nasal colonization. Nature 2010;465:346-9.
9. Sugimoto S, Iwamoto T, Takada K, Okuda K, Tajima A, Iwase T, et al. Staphylococcus epidermidis Esp degrades specific proteins associated with Staphylococcus aureus biofilm formation and host-pathogen interaction. J Bacteriol 2013;195:1645-55.
10. Otto M. Staphylococcus epidermidis – the ‘accidental’ pathogen. Nat Rev Microbiol 2009;7:555-67.
11. Kim HJ, Jo A, Jeon YJ, An S, Lee KM, Yoon SS, et al. Nasal commensal Staphylococcus epidermidis enhances interferon-lambda-dependent immunity against influenza virus. Microbiome 2019;7:80.
12. Fredheim EGA, Flaegstad T, Askarian F, Klingenberg C. Colonisation and interaction between S. epidermidis and S. aureus in the nose and throat of healthy adolescents. Eur J Clin Microbiol Infect Dis 2015;34:123-9.
13. Lee DC, Kananurak A, Tran MT, Connolly PA, Polage CR, Iwase T, et al. Bacterial colonization of the hospitalized newborn: competition between Staphylococcus aureus and Staphylococcus epidermidis. Pediatr Infect Dis J 2019;38:682-6.
14. Martinez-Garcia S, Rodriguez-Martinez S, Cancino-Diaz ME, Cancino-Diaz JC. Extracellular proteases of Staphylococcus epidermidis: roles as virulence factors and their participation in biofilm. APMIS 2018;126:177-85.