Fig. 4. Representative results of disk diffusion method for antimicrobial susceptibility testing in KPC-2 producing K. pneumoniae isolates exhibiting pulsotype B (ST307). (A) shows results of zone diameter for 12 antibiotics on MH 150 Ø agar, (B) shows results of zone diameter for remaining 6 antibiotics on MH 90 Ø agar, and (C) is results of antimicrobial susceptibility. R, resistant; I, intermediate; S, susceptible.
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image
Fig. 3. Representative results of disk diffusion method for antimicrobial susceptibility testing in KPC-2 producing K. pneumoniae isolates exhibiting pulsotype A (ST395). (A) shows results of zone diameter for 12 antibiotics on MH 150 Ø agar, (B) shows results of zone diameter for remaining 6 antibiotics on MH 90 Ø agar, and (C) is results of antimicrobial susceptibility. R, resistant; I, intermediate; S, susceptible.
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image
Table 3. Antimicrobial susceptibility results of KPC-producing K. pneumoniae isolates obtained by Phoenix system
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download table Antimicrobials Total (n = 100) No. (%) Pulsotype A (n = 31) No. (%) Pulsotype B (n = 63) No. (%) Others (n = 6) No. (%) Resistant to Ampicillin 100 (100.0) […]
Fig. 2. Dendrogram of KPC-2-producing K. pneumoniae isolates according to the PFGE band pattern.
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image
Table 2. Patient characteristics
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download table Characteristic Total (n = 100) No. (%) Pulsotype A (n = 31) No. (%) Pulsotype B (n = 63) No. (%) Others (n = 6) No. (%) P-value* Age (yr)† 69.0 [60.1-77.3] 69.0 [60.0-78.0] […]
Fig. 1. Monthly isolation of KPC-2 producing K. pneumoniae isolates stratified by PFGE banding patterns. Bar graphs indicate the numbers of KPC-2 producing K. pneumoniae isolates collected in each nine month in 2018 and arrows indicate the activity performed for eradicating a KPC-type carbapenemase producing K. pneumoniae isolates outbreak. Yellow bar, pulsotype A; Blue bar, pulsotype B; Gray bar, other pulsotypes.
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image
Table 1. Oligonucleotide sequence of the primers used in this study
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download table Target gene Primer name Primer sequence (5′ to 3′) Amplicon size (bp) blaCTX-M-1 CTX-M-1_-48–25F GACTATTCATGTTGTTGTTAWTTC 973 CTX-M-1_+28-+49R TAAGGCGATAAACAAAAACGGA blaCTX-M-9 CTX-M-9_-42—21F GAATACTGATGTAACACGGATT 962 CTX-M-9-1_+23-+44R ATATAAATAGAAAGTGGGGCAC CTX-M-9-2_+27-+46R CTGATCCTTCAACTCAGCAA blaCMY-1 MOXM F GCTGCTCAAGGAGCACAGGAT 520 MOXM R CACATTGACATAGGTGTGGTGC […]
Fig. 1. Time–kill curves of imipenem and meropenem against P. aeruginosa (A) A1701DS, (B) B1707∆oprD, (C) F1709pump↑, (D) B1605∆oprD/pump↑/IMPstrains. Number of bacterial colony forming units are presented to the detection limit (102 CFU/mL). Black circle and black solid line, no antibiotics treated; gray circle and gray solid line, 1×MIC; and open circle and black broken line, 4×MIC.
Ann Clin Microbiol 2020;23:73-80. Killing Dynamics of Carbapenems against Pseudomonas aeruginosa Harboring Varied Determinants of Carbapenem Resistance Download image
Table 1. Carbapenem susceptibility and relative level of efflux pump gene expression in P. aeroginosa strains
Ann Clin Microbiol 2020;23:73-80. Killing Dynamics of Carbapenems against Pseudomonas aeruginosa Harboring Varied Determinants of Carbapenem Resistance Download table P. aeruginosa MIC (mg/L) of* Relative level of expression to A1701DS† Imipenem Meropenem MexAB-OprM MexXY-OprM MexCD-OprJ A1701DS 2 1 1.0 1.0 1.0 B1707ΔoprD 16 8 0.6 0.3 –‡ F1709pump ↑ 32 32 1.4 0.6 0.7 B1605ΔoprD/pump↑IMP […]
Table 2. Isolated specimens of carbapenem-resistant Acinetobacter baumannii in 37 patients
Ann Clin Microbiol 2020;23:67-72. Comparison of Three Methods with CHROMagar for Surveillance Culture of Carbapenem-Resistant Acinetobacter baumannii Download table Isolated specimen No. of patients CHROMagar MCA-IPM TSB-IPM Nasal swab only 13 12 12 Rectal swab only 8 2 3 Nasal and rectal swabs 12 15 17 Total 33 29 32 Abbreviation: CHROMagar, CHROMagar Acinetobacter with […]