Annals of Clinical Microbiology, The official Journal of the Korean Society of Clinical Microbiology

6

Weeks in Review

4

Weeks to Publication
Indexed in KCI, KoreaMed, Synapse, DOAJ
Open Access, Peer Reviewed
pISSN 2288-0585 eISSN 2288-6850

Table 1. Primers used in the study

Ann Clin Microbiol 2025;28(4):23. Prevalence and molecular characteristics of β-lactam resistance in non-typeable Haemophilus influenzae isolates in Korea Download table Target genes Primer name Sequences (5’→3′) Size (bp) References blaTEM TEM (321) TGGGTGCACGAGTGGGTTAC 526 [11] TEM (846) TTATCCGCCTCCATCCAGTC blaROB ROB (419) ATCAGCCACACAAGCCACCT 692 ROB (1110) GTTTGCGATTTGGTATGCGA ftsI F1 (936) GTTAATGCGTAACCGTGCAATTACC 704 [12] F2 (1640) ACCACTAATGCATAACGAGGATC […]

Table 4. Functions of resistance-associated genes and drug resistance mechanisms in Mycobacterium tuberculosis [20]

Ann Clin Microbiol 2025;28(4):26. Drug susceptibility testing for Mycobacterium tuberculosis: a narrative review Download table WHO category Drug or drug class Resistance gene Gene function Mechanism of drug resistance First-line agents Rifampicin rpoB RNA polymerase Target modification Isoniazid katG Catalase-peroxidase enzyme Decreased drug activation inhA NADH-dependent enoyl-acyl carrier protein Target amplification or modification Pyrazinamide pncA […]

Table 3. Critical concentrations of drugs recommended for treating drug-susceptible and multidrug- or rifampicin-resistant tuberculosis

Ann Clin Microbiol 2025;28(4):26. Drug susceptibility testing for Mycobacterium tuberculosis: a narrative review Download table Category Drug Critical concentrations (μg/mL) by medium LJ Middlebrook 7H10 Middlebrook 7H11 MGIT Drug-susceptible TB   First-line drugs Rifampicin 40.0 0.5 1.0 0.5 Isoniazid 0.2 0.2 0.2 0.1 Ethambutola) 2.0 5.0 7.5 5.0 Pyrazinamidea) – – – 100.0 MDR/RR-TB   […]

Table 2. Classification of drugs used in multidrug- and rifampicin-resistant tuberculosis treatment regimens in Korea [5]

Ann Clin Microbiol 2025;28(4):26. Drug susceptibility testing for Mycobacterium tuberculosis: a narrative review Download table Group Anti-TB drug A Levofloxacin or MoxifloxacinBedaquilineDelamanidLinezolid B CycloserineClofazimine C Amikacin or Kanamycin (Streptomycin)EthambutolImipenem-cilastatin or MeropenemPara-aminosalicylc acid (PAS)ProthionamidePyrazinamide Group A: Highly effective core medicines that should be included in all longer MDR/RR-TB regimens unless contraindicated due to toxicity, intolerance, or […]

Table 1. Drug-resistant tuberculosis classifications

Ann Clin Microbiol 2025;28(4):26. Drug susceptibility testing for Mycobacterium tuberculosis: a narrative review Download table Drug-resistance Description Isoniazid-resistant TB (rifampicin-susceptible) (Hr-TB) Tuberculosis caused by Mycobacterium tuberculosis strains that are resistant to isoniazid but remain susceptible to rifampicin. Rifampicin-resistant TB (RR-TB) TB caused by strains resistant to rifampicin, with or without resistance to other first-line drugs. […]

Whole-genome sequencing as the new framework of clinical microbiology and highlights in this issue

Editorial Hae-Sun Chung Department of Laboratory Medicine, Ewha Womans University College of Medicine, Seoul, Korea Correspondence to Hae-Sun Chung, E-mail: sunny0521.chung@ewha.ac.kr Ann Clin Microbiol 2025;28(4):27. https://doi.org/10.5145/ACM.2025.28.4.8Received on 16 December 2025, Revised on 18 December 2025, Accepted on 18 December 2025, Published on 20 December 2025.Copyright © Korean Society of Clinical Microbiology.This is an Open Access […]

Drug susceptibility testing for Mycobacterium tuberculosis: a narrative review

Review article Chang-Ki Kim Department of Laboratory Medicine, Seoul Clinical Laboratories, Yongin, Korea Correspondence to Chang-Ki Kim, E-mail: psoas95@gmail.com Ann Clin Microbiol 2025;28(4):26. https://doi.org/10.5145/ACM.2025.28.4.7Received on 7 December 2025, Revised on 14 December 2025, Accepted on 15 December 2025, Published on 20 December 2025.Copyright © Korean Society of Clinical Microbiology.This is an Open Access article which […]

Clinical evaluation of GenBody hMPV Ag Rapid Test: a diagnostic accuracy study

Original article Sungwook Song, Eunsim Shin, Sunghee Han, Sang Gon Lee Laboratory Medicine Center, Division of Laboratory Medicine, GC Labs, Yongin, Korea Correspondence to Sungwook Song, E-mail: song1221@gclabs.co.kr Ann Clin Microbiol 2025;28(4):25. https://doi.org/10.5145/ACM.2025.28.4.6Received on 26 September 2025, Revised on 9 December 2025, Accepted on 10 December 2025, Published on 20 December 2025.Copyright © Korean Society […]