Table 3. Discrepant results between three real-time PCR assays and AFB culture in AFB smear negative specimens
Ann Clin Microbiol 2020;23:93-104. Evaluation of Diagnostic Performance of Three Real-Time PCR Assays for the Detection of Mycobacteria Species Download table Specimen type AdvanSure Genedia PowerChek AFB culture Sputum NTM Negative NTM No growth Bronchial aspirate NTM Negative NTM NTM Sputum NTM Negative NTM NTM Pleural fluid MTB Negative MTB NTM Sputum Negative Negative NTM […]
Table 2. Discrepant results among three real-time PCR assays and AFB culture in AFB smear positive specimens
Ann Clin Microbiol 2020;23:93-104. Evaluation of Diagnostic Performance of Three Real-Time PCR Assays for the Detection of Mycobacteria Species Download table Specimen type (No.) AdvanSure Genedia PowerChek No. of specimens AFB culture results Sputum (4), Bronchial aspirate (9) NTM Negative NTM 13 NTM Sputum (6), Bronchial aspirate (1) MTB MTB MTB 7 No growth Sputum […]
Table 1. The AFB culture results for the specimens of AFB smear negative and MTB/NTM real-time PCR negative
Ann Clin Microbiol 2020;23:93-104. Evaluation of Diagnostic Performance of Three Real-Time PCR Assays for the Detection of Mycobacteria Species Download table Specimen Results MTB NTM Negative Subtotal (%) Sputum 0 3 68 71 (40.1) Bronchial aspirate 0 2 46 48 (27.1) Pleural fluid 1 1 25 27 (15.3) Cerebrospinal fluid (CSF) 0 0 16 16 […]
Fig. 4. Representative results of disk diffusion method for antimicrobial susceptibility testing in KPC-2 producing K. pneumoniae isolates exhibiting pulsotype B (ST307). (A) shows results of zone diameter for 12 antibiotics on MH 150 Ø agar, (B) shows results of zone diameter for remaining 6 antibiotics on MH 90 Ø agar, and (C) is results of antimicrobial susceptibility. R, resistant; I, intermediate; S, susceptible.
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image
Fig. 3. Representative results of disk diffusion method for antimicrobial susceptibility testing in KPC-2 producing K. pneumoniae isolates exhibiting pulsotype A (ST395). (A) shows results of zone diameter for 12 antibiotics on MH 150 Ø agar, (B) shows results of zone diameter for remaining 6 antibiotics on MH 90 Ø agar, and (C) is results of antimicrobial susceptibility. R, resistant; I, intermediate; S, susceptible.
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image
Table 3. Antimicrobial susceptibility results of KPC-producing K. pneumoniae isolates obtained by Phoenix system
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download table Antimicrobials Total (n = 100) No. (%) Pulsotype A (n = 31) No. (%) Pulsotype B (n = 63) No. (%) Others (n = 6) No. (%) Resistant to Ampicillin 100 (100.0) […]
Fig. 2. Dendrogram of KPC-2-producing K. pneumoniae isolates according to the PFGE band pattern.
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image
Table 2. Patient characteristics
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download table Characteristic Total (n = 100) No. (%) Pulsotype A (n = 31) No. (%) Pulsotype B (n = 63) No. (%) Others (n = 6) No. (%) P-value* Age (yr)† 69.0 [60.1-77.3] 69.0 [60.0-78.0] […]
Fig. 1. Monthly isolation of KPC-2 producing K. pneumoniae isolates stratified by PFGE banding patterns. Bar graphs indicate the numbers of KPC-2 producing K. pneumoniae isolates collected in each nine month in 2018 and arrows indicate the activity performed for eradicating a KPC-type carbapenemase producing K. pneumoniae isolates outbreak. Yellow bar, pulsotype A; Blue bar, pulsotype B; Gray bar, other pulsotypes.
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image
Table 1. Oligonucleotide sequence of the primers used in this study
Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download table Target gene Primer name Primer sequence (5′ to 3′) Amplicon size (bp) blaCTX-M-1 CTX-M-1_-48–25F GACTATTCATGTTGTTGTTAWTTC 973 CTX-M-1_+28-+49R TAAGGCGATAAACAAAAACGGA blaCTX-M-9 CTX-M-9_-42—21F GAATACTGATGTAACACGGATT 962 CTX-M-9-1_+23-+44R ATATAAATAGAAAGTGGGGCAC CTX-M-9-2_+27-+46R CTGATCCTTCAACTCAGCAA blaCMY-1 MOXM F GCTGCTCAAGGAGCACAGGAT 520 MOXM R CACATTGACATAGGTGTGGTGC […]