Annals of Clinical Microbiology, The official Journal of the Korean Society of Clinical Microbiology

6

Weeks in Review

4

Weeks to Publication
Indexed in KCI, KoreaMed, Synapse, DOAJ
Open Access, Peer Reviewed
pISSN 2288-0585 eISSN 2288-6850

Fig. 4. Representative results of disk diffusion method for antimicrobial susceptibility testing in KPC-2 producing K. pneumoniae isolates exhibiting pulsotype B (ST307). (A) shows results of zone diameter for 12 antibiotics on MH 150 Ø agar, (B) shows results of zone diameter for remaining 6 antibiotics on MH 90 Ø agar, and (C) is results of antimicrobial susceptibility. R, resistant; I, intermediate; S, susceptible.

Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image

Fig. 3. Representative results of disk diffusion method for antimicrobial susceptibility testing in KPC-2 producing K. pneumoniae isolates exhibiting pulsotype A (ST395). (A) shows results of zone diameter for 12 antibiotics on MH 150 Ø agar, (B) shows results of zone diameter for remaining 6 antibiotics on MH 90 Ø agar, and (C) is results of antimicrobial susceptibility. R, resistant; I, intermediate; S, susceptible.

Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image

Table 2. Patient characteristics

Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download table Characteristic Total (n = 100) No. (%) Pulsotype A (n = 31) No. (%) Pulsotype B (n = 63) No. (%) Others (n = 6) No. (%) P-value* Age (yr)† 69.0 [60.1-77.3] 69.0 [60.0-78.0] […]

Fig. 1. Monthly isolation of KPC-2 producing K. pneumoniae isolates stratified by PFGE banding patterns. Bar graphs indicate the numbers of KPC-2 producing K. pneumoniae isolates collected in each nine month in 2018 and arrows indicate the activity performed for eradicating a KPC-type carbapenemase producing K. pneumoniae isolates outbreak. Yellow bar, pulsotype A; Blue bar, pulsotype B; Gray bar, other pulsotypes.

Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image

Table 1. Oligonucleotide sequence of the primers used in this study

Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download table Target gene Primer name Primer sequence (5′ to 3′) Amplicon size (bp) blaCTX-M-1 CTX-M-1_-48–25F GACTATTCATGTTGTTGTTAWTTC 973 CTX-M-1_+28-+49R TAAGGCGATAAACAAAAACGGA blaCTX-M-9 CTX-M-9_-42—21F GAATACTGATGTAACACGGATT 962 CTX-M-9-1_+23-+44R ATATAAATAGAAAGTGGGGCAC CTX-M-9-2_+27-+46R CTGATCCTTCAACTCAGCAA blaCMY-1 MOXM F GCTGCTCAAGGAGCACAGGAT 520 MOXM R CACATTGACATAGGTGTGGTGC […]