Annals of Clinical Microbiology, The official Journal of the Korean Society of Clinical Microbiology

6

Weeks in Review

4

Weeks to Publication
Indexed in KCI, KoreaMed, Synapse, DOAJ
Open Access, Peer Reviewed
pISSN 2288-0585 eISSN 2288-6850

Table 2. Patient characteristics

Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download table Characteristic Total (n = 100) No. (%) Pulsotype A (n = 31) No. (%) Pulsotype B (n = 63) No. (%) Others (n = 6) No. (%) P-value* Age (yr)† 69.0 [60.1-77.3] 69.0 [60.0-78.0] […]

Fig. 1. Monthly isolation of KPC-2 producing K. pneumoniae isolates stratified by PFGE banding patterns. Bar graphs indicate the numbers of KPC-2 producing K. pneumoniae isolates collected in each nine month in 2018 and arrows indicate the activity performed for eradicating a KPC-type carbapenemase producing K. pneumoniae isolates outbreak. Yellow bar, pulsotype A; Blue bar, pulsotype B; Gray bar, other pulsotypes.

Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download image

Table 1. Oligonucleotide sequence of the primers used in this study

Ann Clin Microbiol 2020;23:81-92. Epidemiological Study of an Outbreak of KPC-2-producing Klebsiella pneumoniae in a Tertiary Hospital in Korea Download table Target gene Primer name Primer sequence (5′ to 3′) Amplicon size (bp) blaCTX-M-1 CTX-M-1_-48–25F GACTATTCATGTTGTTGTTAWTTC 973 CTX-M-1_+28-+49R TAAGGCGATAAACAAAAACGGA blaCTX-M-9 CTX-M-9_-42—21F GAATACTGATGTAACACGGATT 962 CTX-M-9-1_+23-+44R ATATAAATAGAAAGTGGGGCAC CTX-M-9-2_+27-+46R CTGATCCTTCAACTCAGCAA blaCMY-1 MOXM F GCTGCTCAAGGAGCACAGGAT 520 MOXM R CACATTGACATAGGTGTGGTGC […]

Fig. 1. Time–kill curves of imipenem and meropenem against P. aeruginosa (A) A1701DS, (B) B1707∆oprD, (C) F1709pump↑, (D) B1605∆oprD/pump↑/IMPstrains. Number of bacterial colony forming units are presented to the detection limit (102 CFU/mL). Black circle and black solid line, no antibiotics treated; gray circle and gray solid line, 1×MIC; and open circle and black broken line, 4×MIC.

Ann Clin Microbiol 2020;23:73-80. Killing Dynamics of Carbapenems against Pseudomonas aeruginosa Harboring Varied Determinants of Carbapenem Resistance Download image

Table 1. Carbapenem susceptibility and relative level of efflux pump gene expression in P. aeroginosa strains

Ann Clin Microbiol 2020;23:73-80. Killing Dynamics of Carbapenems against Pseudomonas aeruginosa Harboring Varied Determinants of Carbapenem Resistance Download table P. aeruginosa MIC (mg/L) of* Relative level of expression to A1701DS† Imipenem Meropenem MexAB-OprM MexXY-OprM MexCD-OprJ A1701DS 2 1 1.0 1.0 1.0 B1707ΔoprD 16 8 0.6 0.3 –‡ F1709pump ↑ 32 32 1.4 0.6 0.7 B1605ΔoprD/pump↑IMP […]

Evaluation of the AdvanSure TB/NTM Plus Real-Time PCR Assay for the Simultaneous Detection of Mycobacterium tuberculosis and Nontuberculous Mycobacteria from Clinical Specimens

Original article Chorong Hahm1,2, Min-Kyung So1, Hae-Sun Chung1, Miae Lee1 1Department of Laboratory Medicine, Ewha Womans University College of Medicine, Seoul, 2Eone Laboratories, Seoul, Korea. Corresponding to Miae Lee, E-mail: miae@ewha.ac.kr  Ann Clin Microbiol 2020;23(2):105-116. https://doi.org/10.5145/ACM.2020.23.2.7Received on 5 March 2020, Revised on 28 April 2020, Accepted on 14 May 2020, Published on 20 June 2020.Copyright […]

Evaluation of Diagnostic Performance of Three Real-Time PCR Assays for the Detection of Mycobacteria Species

Original article Sang-wook Kim1*, Young-Hee Park2*, Young Jin Ko1,3, Yoon Ho Kim2, Chang Hyun Kim2, Chae Seung Lim1 Department of Laboratory Medicine, 1Korea University College of Medicine, Seoul, 2Korea University Medical Center Guro Hospital, Seoul, 3Department of Laboratory Medicine, College of Medicine, Chosun University, Gwangju, Korea *These authors contributed equally to this work. Corresponding to […]